WormMine: Gene WBGene00038518

• WormBase Gene ID: WBGene00038518
• Gene Name: CBG19264
• Sequence Name: CBG19264
• Organism: Caenorhabditis briggsae
• Automated Description: Is affected by Cbr-spr-4 based on RNA-seq studies. Is predicted to encode a protein with the following domains: Protein kinase-like domain superfamily; CHK kinase-like; Uncharacterized oxidoreductase dhs-27; and Uncharacterised oxidoreductase Dhs-27. Is an ortholog of C. elegans E02C12.6 and E02C12.8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19264.1	CBG19264.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19264	CBG19264		[unknown]

0 RNAi Result

7 Allele

• WBVar00127330
• WBVar00127329
• WBVar00127328
• WBVar00127327
• WBVar00127326
• WBVar00025874
• WBVar00025879

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_downregulated
Virus infection: Santeuil infected at L3 larva stage for 12 hours.	Transcripts that showed signicantly decreased expression after Santeuil virus infection to C. briggsae strain JU1264.	edgeR, FDR < 0.05.	WBPaper00051137:Santeuil-virus_downregulated_JU1264

1 Expression Patterns

• Primary Identifier: Expr1069371
• Remark: CBG19264, TGATGAATTTCGAAGGTGGACAAGGTTTTGGAGTAGAAAAATTGAAAAAGTTGTCTGCAT, WBGene00038518
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term