WormMine: Gene WBGene00038282

• WormBase Gene ID: WBGene00038282
• Gene Name: Cbr-cest-31
• Sequence Name: CBG18991
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Carboxylesterase family; Carboxylesterase, type B; Esterase CM06B1-like; and Alpha/Beta hydrolase fold. Is an ortholog of C. elegans cest-31.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18991.1	CBG18991.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18991	CBG18991		[unknown]

0 RNAi Result

5 Allele

• WBVar00127130
• WBVar00127133
• WBVar00127132
• WBVar00127131
• WBVar00127129

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059072
• Remark: CBG18991, TCTTTTGGACCAAACCTTGATTATGACTTCTTTCCCAAACCACTGGAAGAATTGAGAATT, WBGene00038282
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term