WormMine: Gene WBGene00039308

• WormBase Gene ID: WBGene00039308
• Gene Name: Cbr-trak-1
• Sequence Name: CBG20286
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: HAP1 N-terminal conserved region and HAP1, N-terminal. Is an ortholog of C. elegans trak-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20286.1	CBG20286.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20286	CBG20286		[unknown]

0 RNAi Result

27 Allele

• WBVar00128447
• WBVar00128446
• WBVar00128445
• WBVar00128444
• WBVar00128461
• WBVar00128460
• WBVar00128465
• WBVar00128464
• WBVar00128463
• WBVar00128462
• WBVar00128466
• WBVar00128459
• WBVar00128450
• WBVar00128454
• WBVar00128453
• WBVar00128452
• WBVar00128451
• WBVar00128458
• WBVar00128457
• WBVar00128456
• WBVar00128455
• WBVar00128449
• WBVar00128448
• WBVar00028752
• WBVar00028757
• WBVar00028762
• WBVar00028767

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056846
• Remark: CBG20286, TTTGCAGCGTTTTGTCAACGGAAAGGTATCGATCAGCAACAGTTTTTCGGTAGTAGTCAG, WBGene00039308
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term