WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00034154 Gene Name  CBG13378
Sequence Name  ? CBG13378 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domain: CUB-like domain. Is an ortholog of C. elegans ZK896.4. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG13378.1 CBG13378.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG13378 CBG13378   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00024979

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG13378, ACGTTTTATATCACAAGGATTGATATGGCAACTGATAACAAGCTTTCAGTCTATAACGGA, WBGene00034154   Expr1056664 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term