WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00036456 Gene Name  Cbr-ten-1
Sequence Name  ? CBG16546 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Tox-GHH domain; EGF-like domain; Six-bladed beta-propeller, TolB-like; and GHH signature containing HNH/Endo VII superfamily nuclease toxin. Is an ortholog of C. elegans ten-1. In C. elegans, ten-1 is involved in several processes, including body morphogenesis; inductive cell migration; and system development. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG16546a.1 CBG16546a.1   [unknown]
Transcript:CBG16546b.1 CBG16546b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG16546b CBG16546b   [unknown]
CDS:CBG16546a CBG16546a   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00021487

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG25928, AATGGATAACGGCGGATCGAAAGTTCCTGTATTAGCTGTCGGAACGTACCACCGGAAGGA, WBGene00087342   Expr1056850 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cbr-ten-1, CTCAGTTCAACCTCGTTCCCACATTTCACAATGGCTGTAAACAAAGAAAGTGTGGAATTG, WBGene00036456   Expr1056108 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term