WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00039596 Gene Name  Cbr-spsb-1
Sequence Name  ? CBG20654 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: B30.2/SPRY domain superfamily; SOCS box; Concanavalin A-like lectin/glucanase domain superfamily; SPRY domain; and SOCS box domain. Is an ortholog of C. elegans spsb-1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG20654a.1 CBG20654a.1   [unknown]
Transcript:CBG20654c.1 CBG20654c.1   [unknown]
Transcript:CBG20654b.1 CBG20654b.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG20654c CBG20654c   [unknown]
CDS:CBG20654a CBG20654a   [unknown]
CDS:CBG20654b CBG20654b   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00029452
WBVar00029447

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG25662, TTATGGATGCATTGAGTTATAGAAGACCAGTAAGTGATAACCTTCATCGGGTACACCTAG, WBGene00087076   Expr1058667 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cbr-spsb-2, TATGGGGACACTGCGAAATCAGCATGCGCTATCTTGGATCTCTTGAACGTGAGCTTATTT, WBGene00039596   Expr1051266 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term