WormMine: Gene WBGene00027759

• WormBase Gene ID: WBGene00027759
• Gene Name: Cbr-hpl-1
• Sequence Name: CBG05267
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Chromo/chromo shadow domain; Chromo (CHRromatin Organisation MOdifier) domain; Chromo-like domain superfamily; and Chromo domain. Is an ortholog of C. elegans hpl-1. In C. elegans, hpl-1 is involved in several processes, including developmental process involved in reproduction; negative regulation of Ras protein signal transduction; and negative regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05267.1	CBG05267.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05267	CBG05267		[unknown]

0 RNAi Result

1 Allele

• WBVar00110218

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062687
• Remark: CBG05267, AAAGGTGCATGGTCTCACGACAGCATCAGGGAAACTTCAATATTTGTGTTGTTTTGTGGA, WBGene00027759
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term