WormMine: Gene WBGene00036982

• WormBase Gene ID: WBGene00036982
• Gene Name: CBG17314
• Sequence Name: CBG17314
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Kazal domain; Kazal-type serine protease inhibitor domain; and Kazal domain superfamily. Is an ortholog of C. elegans F29G6.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17314a.1	CBG17314a.1		[unknown]
Transcript:CBG17314b.1	CBG17314b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17314a	CBG17314a		[unknown]
CDS:CBG17314b	CBG17314b		[unknown]

0 RNAi Result

2 Allele

• WBVar00125130
• WBVar00022972

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063025
• Remark: CBG17314, GTCATTTGTGACCAACACGAGAACATCTACCGTAACTCTTGCTATTTCAACCTGAAAGCT, WBGene00036982
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term