WormMine: Gene WBGene00180455

• WormBase Gene ID: WBGene00180455
• Gene Name: CJA24883
• Sequence Name: CJA24883
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Reverse transcriptase domain; Reverse transcriptase (RNA-dependent DNA polymerase); DNA/RNA polymerase superfamily; and Endonuclease/exonuclease/phosphatase superfamily. Is an ortholog of C. elegans F52C9.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA24883a.1	CJA24883a.1		[unknown]
Transcript:CJA24883c.1	CJA24883c.1		[unknown]
Transcript:CJA24883b.1	CJA24883b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA24883b	CJA24883b		[unknown]
CDS:CJA24883a	CJA24883a		[unknown]
CDS:CJA24883c	CJA24883c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1071990
• Remark: CJA27407, AACGTAACGCTTAACAACGTTACTACCTGCATTGAAGAGGTCAATGAGTACGTCTACCTC, WBGene00182979
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term