WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00068823 Gene Name  CRE06144
Sequence Name  ? CRE06144 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Beta-grasp domain superfamily; Molybdopterin synthase/thiamin biosynthesis sulphur carrier, beta-grasp; ThiS family; and Sulfur carrier ThiS/MoaD-like. Is an ortholog of C. elegans moc-6. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE06144.1 CRE06144.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE06144 CRE06144   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE06144, ATACGCCAATCCAGGAGACCGTTTCGAGTTGGAACGTTTCACAGAAATCGCCGTGATTCC, WBGene00068823   Expr1103843 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term