WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00042045 Gene Name  Cbr-dxbp-1
Sequence Name  ? CBG23783 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Ribosomal protein L2, domain 2; DNA/RNA-binding protein KIN17, WH-like domain superfamily; Domain of Kin17 curved DNA-binding protein; KN17, SH3-like C-terminal domain; KIN17-like protein; KN17 SH3-like C-terminal domain; Zinc finger C2H2 superfamily; and DNA/RNA-binding protein Kin17, WH-like domain. Is an ortholog of C. elegans dxbp-1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG23783.1 CBG23783.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG23783 CBG23783   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG23783, TCAAGTGAAGCTGGACGATGGTACGGTAGTCAAATTGGATCAAGAACACGTGGAAACCGT, WBGene00042045   Expr1067411 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term