WormMine: Gene WBGene00042045

• WormBase Gene ID: WBGene00042045
• Gene Name: Cbr-dxbp-1
• Sequence Name: CBG23783
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Ribosomal protein L2, domain 2; DNA/RNA-binding protein KIN17, WH-like domain superfamily; Domain of Kin17 curved DNA-binding protein; KN17, SH3-like C-terminal domain; KIN17-like protein; KN17 SH3-like C-terminal domain; Zinc finger C2H2 superfamily; and DNA/RNA-binding protein Kin17, WH-like domain. Is an ortholog of C. elegans dxbp-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23783.1	CBG23783.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23783	CBG23783		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067411
• Remark: CBG23783, TCAAGTGAAGCTGGACGATGGTACGGTAGTCAAATTGGATCAAGAACACGTGGAAACCGT, WBGene00042045
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term