WormMine: Gene WBGene00086754

• WormBase Gene ID: WBGene00086754
• Gene Name: CBG25340
• Sequence Name: CBG25340
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Domain of unknown function DUF676, lipase-like; Alpha/Beta hydrolase fold; Putative serine esterase (DUF676); and Lipase-like. Is an ortholog of C. elegans C09D4.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG25340a.1	CBG25340a.1		[unknown]
Transcript:CBG25340b.1	CBG25340b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG25340a	CBG25340a		[unknown]
CDS:CBG25340b	CBG25340b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053154
• Remark: CBG25340, GTTATCGCCTTGGAAGATTCTGTTTTCATCGAGAAACTTTTCAACATCTCTGCAGTCAAG, WBGene00086754
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term