WormMine: Gene WBGene00136179

• WormBase Gene ID: WBGene00136179
• Gene Name: CJA16973
• Sequence Name: CJA16973
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Thrombospondin type 1 domain; Thrombospondin type-1 (TSP1) repeat superfamily; and Thrombospondin type-1 (TSP1) repeat. Is an ortholog of C. elegans C36B7.5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA16973c.1	CJA16973c.1		[unknown]
Transcript:CJA16973a.1	CJA16973a.1		[unknown]
Transcript:CJA16973b.1	CJA16973b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA16973a	CJA16973a		[unknown]
CDS:CJA16973c	CJA16973c		[unknown]
CDS:CJA16973b	CJA16973b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1089779
• Remark: CJA16973, AGTTGGAGCAAATGTCACGAGAATTCGATTCGTGAGAGAAAACGCTTCTGTATCGGTCAA, WBGene00136179
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term