WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00037214 Gene Name  Cbr-cyb-1
Sequence Name  ? CBG17647 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Cyclin-like; Cyclin; Cyclin, C-terminal domain; Cyclin-like superfamily; Cyclin, N-terminal; and Cyclin, N-terminal domain. Is an ortholog of C. elegans cyb-1. In C. elegans, cyb-1 is involved in mitotic cell cycle; oocyte maturation; and positive regulation of protein phosphorylation. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG17647a.1 CBG17647a.1   [unknown]
Transcript:CBG17647b.1 CBG17647b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG17647a CBG17647a   [unknown]
CDS:CBG17647b CBG17647b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-cyb-1, TCGACACACCTGACCGATGAGGTTTTGGACAAGATCGAAGCCATGGGAAGGCAGAATTGA, WBGene00037214   Expr1059382 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term