WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00122868 Gene Name  Cjp-eat-17
Sequence Name  ? CJA03664 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Rab-GTPase-TBC domain; Ecotropic viral integration site 5 protein; and Rab-GTPase-TBC domain superfamily. Is an ortholog of C. elegans eat-17. In C. elegans, eat-17 is involved in positive regulation of feeding behavior and regulation of presynaptic dense core granule exocytosis. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA03664.1 CJA03664.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA03664 CJA03664   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-tbc-4, ATGGAAGGGATGTTGAAATATTTCCAGCGAGAGGTTCGAGAGAGATATGAAAACGACGCG, WBGene00131426   Expr1077994 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA03664, GTATTCGGAAGCAATGTCCACCATTCAAGACTTGCGATACAAGATTTCTCAGCTCGAGCT, WBGene00122868   Expr1082537 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term