WormMine: Gene WBGene00120276

• WormBase Gene ID: WBGene00120276
• Gene Name: Cjp-mop-25.1
• Sequence Name: CJA01072
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Mo25-like; Armadillo-type fold; and Armadillo-like helical. Is an ortholog of C. elegans mop-25.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA01072a.1	CJA01072a.1		[unknown]
Transcript:CJA01072b.1	CJA01072b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA01072b	CJA01072b		[unknown]
CDS:CJA01072a	CJA01072a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1090335
• Remark: Cjp-mop-25.1, TCGAGTTTCTTGGTGAATTCCATAACGACAGAACGGATGACGAACAGTTTAACGACGAAA, WBGene00120276
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term