WormMine: Gene WBGene00270510

• WormBase Gene ID: WBGene00270510
• Gene Name: CBG30272
• Sequence Name: CBG30272
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Ankyrin repeat; Domain of unknown function DUF3447; 26S proteasome non-ATPase regulatory subunit 10-like; Ankyrin repeat-containing domain superfamily; and Ankyrin repeats (3 copies).
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG30272.1	CBG30272.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG30272	CBG30272		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061627
• Remark: Cbr-sec-20, GGAAAGTGTAGTTTGGACAGGCAGGATAGCGAAGGGAACACTGCACTGTTAGTGGTTCAA, WBGene00035868
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term