WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00040010 Gene Name  Cbr-cutl-19
Sequence Name  ? CBG21157 Organism  Caenorhabditis briggsae
Automated Description  Is an ortholog of C. elegans cutl-19. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG21157a.1 CBG21157a.1   [unknown]
Transcript:CBG21157b.1 CBG21157b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG21157a CBG21157a   [unknown]
CDS:CBG21157b CBG21157b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-syx-16, CTATGAAGCCATGTGGAATAGCTCCTCGAAAGTGAAAAATCTCTGTTTTCCTTCTCCATC, WBGene00040010   Expr1060616 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term