WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00040950 Gene Name  Cbr-sas-6
Sequence Name  ? CBG22377 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Spindle assembly abnormal protein 6, N-terminal; SAS-6, N-terminal domain superfamily; and Centriolar protein SAS N-terminal. Is an ortholog of C. elegans sas-6. In C. elegans, sas-6 is involved in centriole replication; protein localization; and regulation of cell cycle. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG22377.1 CBG22377.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG22377 CBG22377   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-sas-6, CAAGTGCTGGCGTCGGATTCAAGACGGTTTTAGGCCAGAATTCACCATATGCCAATAATC, WBGene00040950   Expr1060361 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term