WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00136468 Gene Name  CJA17263
Sequence Name  ? CJA17263 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Sterile alpha motif domain; Ankyrin repeat; Phosphotyrosine interaction domain (PTB/PID); PTB/PI domain; Sterile alpha motif/pointed domain superfamily; Domain of unknown function DUF3447; SAM domain (Sterile alpha motif); Ankyrin repeat-containing domain superfamily; Ankyrin repeats (3 copies); and PH-like domain superfamily. Is an ortholog of C. elegans C11E4.6 and C46H3.2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA17263.1 CJA17263.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA17263 CJA17263   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA17263, AGCCGCATGGATAACAATTTGCCGATAGACGGTACCATTGTGAAATGTCGCCATCAGAAA, WBGene00136468   Expr1072086 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term