WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00122012 Gene Name  CJA02808
Sequence Name  ? CJA02808 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Armadillo-type fold and SPIN90/Ldb17, leucine-rich domain. Is an ortholog of C. elegans Y55F3AM.5. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA02808a.1 CJA02808a.1   [unknown]
Transcript:CJA02808b.1 CJA02808b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA02808b CJA02808b   [unknown]
CDS:CJA02808a CJA02808a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA02808, ACATCTTTGCGTCTGTTGCTCGCCACAAAAACGGTAAATTCCGACGATGATATAGAGTAC, WBGene00122012   Expr1076301 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA24816, TGATGAAGATGAGGAAGGAGGGGAATTCTCGATGGAAGATGTCATGAACATTATTAGAGA, WBGene00180388   Expr1078898 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term