WormMine: Gene WBGene00039574

• WormBase Gene ID: WBGene00039574
• Gene Name: Cbr-acs-11
• Sequence Name: CBG20626
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: AMP-dependent synthetase/ligase; AMP-binding enzyme C-terminal domain; ANL, N-terminal domain; AMP-binding enzyme, C-terminal domain; and AMP-binding enzyme. Is an ortholog of C. elegans acs-11. In C. elegans, acs-11 is involved in IRE1-mediated unfolded protein response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20626.1	CBG20626.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20626	CBG20626		[unknown]

0 RNAi Result

1 Allele

• WBVar00029432

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057413
• Remark: CBG20626, GCCGTTGTTGCAGTTGTAGTTCCAGCAGAGAAAGTGACCGATGAGAAGGAGTTTGAGAAA, WBGene00039574
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term