WormMine: Gene WBGene00120545

• WormBase Gene ID: WBGene00120545
• Gene Name: CJA01341
• Sequence Name: CJA01341
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Ankyrin repeat; Domain of unknown function WSN; Domain of unknown function DUF3447; BRCT domain superfamily; Domain of unknown function; Ankyrin repeat-containing domain superfamily; and Ankyrin repeats (3 copies). Is an ortholog of C. elegans F56D5.9.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA01341b.1	CJA01341b.1		[unknown]
Transcript:CJA01341a.1	CJA01341a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA01341b	CJA01341b		[unknown]
CDS:CJA01341a	CJA01341a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1090000
• Remark: CJA01341, GAGATGCATGTGAAGTATGATCCGGAAAGAAAACCGCCTATCCCTGTTTATAACGAGGAT, WBGene00120545
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term