1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00006961 | xnp-1 | B0041.7 | Caenorhabditis elegans |
| WormBase ID | WBStrain00021973 | CGC Received | 2005-04-29 |
| Genotype | xnp-1(tm678) I. | Laboratory | CGC |
| Made By | WBPerson499 | Mutagen | UV+TMP |
| Name | IG256 | Outcrossed | x3 |
| Remark | Temperature sensitive. Sterile at 25C. Larval lethel with lin-35 and hlp-2. The deletion extends 673 bp (and not 674 + 1 insertion as described on the S. Mitani website). The deletion breakpoint is AAAAAAAGAGCTGAAACATCGGAAGAGTCA/AGATGCAGAGAGAGCAGAGAAAGAGAGA AGA. B0041.7 Reference: Cardoso C, et al. Dev Biol. 2005 Feb 1;278(1):49-59. | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00006961 | xnp-1 | B0041.7 | Caenorhabditis elegans |
