WormMine

WS296

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00022637 CGC Received  2009-05-19
Genotype  mut-16(mg461) I; larp-1(q783) III. Laboratory  CGC
Made By  WBPerson3087 Name  JK3826
Outcrossed  x7 Remark  Slow growing and throw about 10% dead embryos. q783 is a deletion of the first 4 exons on the larp-1 gene. NOTE: this strain is carrying mut-16(mg461) in the background; It is unknown if mg461 is homozygous in this strain. See JK4545 for a replacement larp-1(q783) strain. mut-16 can be detected using primer1 CCCGCCGATACAGAAACTAA, primer 2 AATATTCGATCGGCAAGCAG for genotyping. The wild-type locus will yield a 824bp PCR product, whereas mg461 will yield a 373bp product. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Species  Caenorhabditis elegans

2 Alleles

Public Name
q783
mg461

1 Data Sets

Name URL
WormBaseAcedbConverter  

2 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00003508 mut-16 B0379.3 Caenorhabditis elegans
WBGene00020097 larp-1 R144.7 Caenorhabditis elegans