WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00042520 Gene Name  CBG24397
Sequence Name  ? CBG24397 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Impact family; RWD domain; Impact, N-terminal; Ubiquitin-conjugating enzyme/RWD-like; Uncharacterized protein family UPF0029; Impact, N-terminal domain superfamily; and Ribosomal protein S5 domain 2-type fold. Is an ortholog of C. elegans impt-1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG24397.1 CBG24397.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG24397 CBG24397   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG24397, GATGACATGAATATCCAGCATGGAGAGGTCTTCACAGACCGGAAAAGTGCATTTCAGGCA, WBGene00042520   Expr1058856 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG08009, GGGATCCACTTGGGACCAGATCGCTTCCGGCACATCAATAATTTAACACGACAAATTTTA, WBGene00029883   Expr1050212 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term