WormMine: Gene WBGene00032042

• WormBase Gene ID: WBGene00032042
• Gene Name: Cbr-plin-1
• Sequence Name: CBG10763
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Perilipin and Perilipin family. Is an ortholog of C. elegans plin-1. In C. elegans, plin-1 is involved in embryo development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10763a.1	CBG10763a.1		[unknown]
Transcript:CBG10763b.1	CBG10763b.1		[unknown]
Transcript:CBG10763b.2	CBG10763b.2		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10763a	CBG10763a		[unknown]
CDS:CBG10763b	CBG10763b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053589
• Remark: Cbr-mdt-28, AAGGTGGCTCCAGAAGAGATGCTGATGAAACACATTCAACAGAGTTCCGAACAGTTGGCT, WBGene00032042
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term