WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00022439 CGC Received  2014-11-11
Genotype  nos-2(ax2033) II. Laboratory  CGC
Mutagen  CRISPR_Cas9 Name  JH3180
Outcrossed  x0 Remark  Maintain at 20C. ax2033 was produced by replacing +16 to +42 with TCGACTCTCGAACGATCGTAATAG in the first exon of nos-2. ax2033 mutants are sterile when fed nos-1 dsRNA. Reference: Paix A, et al. Genetics. 2014 Sep 23.
Species  Caenorhabditis elegans

1 Alleles

Public Name
ax2033

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00003784 nos-2 ZK1127.1 Caenorhabditis elegans