WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00022440 CGC Received  2014-11-11
Genotype  gtbp-1(ax2035[gtbp-1::TetraCys]) IV. Laboratory  CGC
Made By  WBPerson13788 Mutagen  CRISPR_Cas9
Name  JH3182 Outcrossed  x0
Remark  Maintain at 20-25C. ax2035 was produced by mutation of the sgRNA site and insertion of TetraCys tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence GCAGCATCCTGGGCAGCAATTTTGTCCGGCATTTTGGAAACCGCTGCGCATTCCTCCACGT between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23. Species  Caenorhabditis elegans
Paste the following link
Lists
This Strain isn't in any lists. Upload a list.

1 Alleles

Public Name
ax2035

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00010677 gtbp-1 K08F4.2 Caenorhabditis elegans