WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00042176 Gene Name  Cbr-sdc-1
Sequence Name  ? CBG23946 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Zinc finger C2H2-type and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans sdc-1. In C. elegans, sdc-1 is involved in dosage compensation by hypoactivation of X chromosome; negative regulation of transcription by RNA polymerase II; and sex determination. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG23946.1 CBG23946.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG23946 CBG23946   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG26670, AAAGGTCCAGAAGACCCCAAGAAGAAGTCCGACACCAGAAGACGTTGAACCAGAAGACGT, WBGene00088084   Expr1067348 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cbr-sdc-1, GGAAGCGACGAAAAGCGTGTTTCGCATCGTTTTGAGATATACAACAGCTGGTTCGGTTAT, WBGene00042176   Expr1056714 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term