WormMine: Gene WBGene00136475

• WormBase Gene ID: WBGene00136475
• Gene Name: Cjp-die-1
• Sequence Name: CJA17270
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger C2H2-type and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans die-1. In C. elegans, die-1 is involved in several processes, including cell fate specification; maintenance of left/right asymmetry; and neuron development involved in amphid sensory organ development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA17270.1	CJA17270.1		[unknown]
Transcript:CJA17270.2	CJA17270.2		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA17270	CJA17270		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1090660
• Remark: Cjp-die-1, GGCAAGGCGCTCGGAGAGAAGGTGTTCCCGACGCAGACCTTTTTGGTCAGAAGCAATGAT, WBGene00136475
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term