WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00023468 CGC Received  2007-10-18
Genotype  kgb-1(um3) kgb-2(km16) IV. Laboratory  CGC
Made By  WBPerson2053 Mutagen  UV+TMP
Name  KB7 Outcrossed  x6
Remark  Deletion alleles. Can be maintained at 20C. Sterile at 26C. Can use PCR with the following primer to determine whether both deletions are present. (5'end)5'GGTCTACCAGAGTTTGTGCGCAATC3' (3'end)5'GATAGCCTTGCACTTCGTTG3'. PCR products from wild type show two bands; kgb-1 gene shows a smaller band; kgb-2 gene shows a bigger band.The double mutant should have no PCR product. [NOTE: The 5' primer sequence was corrected 03/28/12 (K. Bennett)] Species  Caenorhabditis elegans

2 Alleles

Public Name
km16
um3

1 Data Sets

Name URL
WormBaseAcedbConverter  

2 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00002187 kgb-1 T07A9.3 Caenorhabditis elegans
WBGene00002188 kgb-2 ZC416.4 Caenorhabditis elegans