2 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00002187 | kgb-1 | T07A9.3 | Caenorhabditis elegans |
WBGene00002188 | kgb-2 | ZC416.4 | Caenorhabditis elegans |
WormBase ID | WBStrain00023468 | CGC Received | 2007-10-18 |
Genotype | kgb-1(um3) kgb-2(km16) IV. | Laboratory | CGC |
Made By | WBPerson2053 | Mutagen | UV+TMP |
Name | KB7 | Outcrossed | x6 |
Remark | Deletion alleles. Can be maintained at 20C. Sterile at 26C. Can use PCR with the following primer to determine whether both deletions are present. (5'end)5'GGTCTACCAGAGTTTGTGCGCAATC3' (3'end)5'GATAGCCTTGCACTTCGTTG3'. PCR products from wild type show two bands; kgb-1 gene shows a smaller band; kgb-2 gene shows a bigger band.The double mutant should have no PCR product. [NOTE: The 5' primer sequence was corrected 03/28/12 (K. Bennett)] | Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00002187 | kgb-1 | T07A9.3 | Caenorhabditis elegans |
WBGene00002188 | kgb-2 | ZC416.4 | Caenorhabditis elegans |