2 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00002061 | ife-3 | B0348.6 | Caenorhabditis elegans |
| WBGene00006770 | unc-34 | Y50D4C.1 | Caenorhabditis elegans |
| WormBase ID | WBStrain00024076 | CGC Received | 2005-02-28 |
| Genotype | ife-3(ok191)/unc-34(e566) V. | Laboratory | CGC |
| Made By | WBPerson1666 | Mutagen | UV+TMP |
| Name | KX10 | Outcrossed | x10 |
| Remark | At 20C heterozygotes segregate WT heterozygotes, Unc unc-34(e566) homozygotes, and Mog ife-3(ok191) homozygotes. At 25C ife-3(ok191) homozygotes are not always Mog, but progeny of the non-Mog homozygotes are embryonic lethal. Deletion of 686 bp from ife-3 removes proximal promoter and all of exon 1. Breakpoint determined by B. Keiper is: taattttcatattttccgct/tatcta/ttatcgattttttccagatg. Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 3; B0348.6); paralog of human eIF4E isoform. | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00002061 | ife-3 | B0348.6 | Caenorhabditis elegans |
| WBGene00006770 | unc-34 | Y50D4C.1 | Caenorhabditis elegans |
