1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00044798 | tbx-43 | Y46E12A.4 | Caenorhabditis elegans |
Oops!
http://intermine.wormbase.org/tools/wormmine/service/ is incorrect| WormBase ID | WBStrain00050762 | CGC Received | 2020-10-21 |
| Genotype | tbx-43(luc131) III. | Laboratory | CGC |
| Name | MLC1776 | Outcrossed | x0 |
| Remark | Wild-type morphology. CRISPR/Cas9 engineered 952 bp deletion of the tbx-43 locus. Flanking sequence: aattagtttttagctccagaagtcggggccgcgccacgttgcatgctcgg / ggcgcttatggaaaaatcattgtggcgggaattcgattcgcagtgtaatg Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421 | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00044798 | tbx-43 | Y46E12A.4 | Caenorhabditis elegans |
