WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00050762 CGC Received  2020-10-21
Genotype  tbx-43(luc131) III. Laboratory  CGC
Name  MLC1776 Outcrossed  x0
Remark  Wild-type morphology. CRISPR/Cas9 engineered 952 bp deletion of the tbx-43 locus. Flanking sequence: aattagtttttagctccagaagtcggggccgcgccacgttgcatgctcgg / ggcgcttatggaaaaatcattgtggcgggaattcgattcgcagtgtaatg Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421 Species  Caenorhabditis elegans

0 Alleles

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00044798 tbx-43 Y46E12A.4 Caenorhabditis elegans