WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00121015 Gene Name  Cjp-fig-1
Sequence Name  ? CJA01811 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Thrombospondin type-1 (TSP1) repeat superfamily; Thrombospondin type-1 (TSP1) repeat; and C6 domain. Is an ortholog of C. elegans fig-1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA01811b.1 CJA01811b.1   [unknown]
Transcript:CJA01811a.1 CJA01811a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA01811b CJA01811b   [unknown]
CDS:CJA01811a CJA01811a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-fig-1, TGTAACAAGCCACTGGACTCGTGCACTTGTTCTGGGTGAGTGTGGGAAAGTAAAAAATGA, WBGene00121015   Expr1087232 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA23029, GAAAAATCCTAGACAAAAACGACATCATCCTCTTCGCGTTTCTACTGCTCGCCATCGTTC, WBGene00178601   Expr1089125 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term