1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00043308 | tmem-107 | F39B2.9 | Caenorhabditis elegans |
| WormBase ID | WBStrain00029256 | CGC Received | 2016-10-27 |
| Genotype | tmem-107(oq100) I. | Laboratory | CGC |
| Made By | WBPerson11843 | Mutagen | CRISPR_Cas9 |
| Name | OEB800 | Outcrossed | x2 |
| Remark | F39B2.9/TMEM-107 has been shown to control the localization of 4 peripheral ciliary transition zone proteins. tmem-107(oq100); nphp-4(tm925) double mutants display ultra-structural malformations in ciliary transition zones, and exhibit sensory abnormalities including roaming, chemoattractant, and dye-filling defects. TRAM-1::tdTomato leaks into cilia in oq100 mutants. Genotyping primers: Forward cgcggttcttcttgtttctt, Reverse wildtype gagatcgagacggcgacg, Reverse oq100 gaaaaacaacgtggaagtcca. Reference: Lambacher NJ, et al. Nat Cell Biol. 2016 Jan;18(1):122-31. | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00043308 | tmem-107 | F39B2.9 | Caenorhabditis elegans |
