WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00043042 Gene Name  CBG25094
Sequence Name  ? CBG25094 Organism  Caenorhabditis briggsae
Automated Description  Is affected by Cbr-htz-1 based on RNA-seq studies. Is predicted to encode a protein with the following domains: Histidine kinase/HSP90-like ATPase superfamily; Morc, S5 domain 2-like; Morc6 ribosomal protein S5 domain 2-like; and Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase. Is an ortholog of C. elegans morc-1. In C. elegans, morc-1 is involved in DNA topological change. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG25094.1 CBG25094.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG25094 CBG25094   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-htz-1(gu167)_upregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG25094, GTGGAGTACAACGGCGATATGTCGACGGAGAGCTTGAACAAGACGATTCACGAAATACAA, WBGene00043042   Expr1064761 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term