1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00003299 | mir-71 | F16A11.4 | Caenorhabditis elegans |
| WormBase ID | WBStrain00027418 | CGC Received | 2007-11-16 |
| Genotype | mir-71(n4115) I. | Laboratory | CGC |
| Mutagen | UV+TMP | Name | MT12993 |
| Outcrossed | x0 | Remark | Deletion breakpoints are: CGATCCCGACGGCGAAAAACAG / AATAGTGATACGAC...TGTGTGTGAGCTA / GTTTCAACACTGAGGTTTTGTTGGAAAGT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00003299 | mir-71 | F16A11.4 | Caenorhabditis elegans |
