WormMine: Strain WBStrain00027431

• WormBase ID: WBStrain00027431
• CGC Received: 2007-11-16
• Genotype: mir-34(n4276) X.
• Laboratory: CGC
• Mutagen: EMS
• Name: MT13406
• Outcrossed: x0
• Remark: Deletion breakpoints are: AACAACAACAAAAACTTTTTTTACC / ATTTAAAAAAATAA...GAATGGGAAAAAAAA / GGAAGCTGTGGCCTGTCGCATAGTTAC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
• Species: Caenorhabditis elegans

1 Alleles

Public Name
n4276

1 Data Sets

• WormBaseAcedbConverter

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00003262	mir-34	Y41G9A.7	Caenorhabditis elegans