WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00027645 CGC Received  2007-04-23
Genotype  ifta-1(nx61) X. Laboratory  CGC
Made By  WBPerson6201 Mutagen  Tc1
Name  MX124 Outcrossed  x8
Remark  Homozygous viable with no obvious morphological, locomotory, or behavioral phenotypes. However, these animals display cilia-related chemosensory (Che) defective and dye-fill (Dyf) defective phenotypes. 2009 bp deletion with flanking sequences of GATAAGAGGAAATCTTTTTGGAGAGTTGGA and ATTTAGTTTTTCACAAAGAACACCGCAATA. Species  Caenorhabditis elegans
Paste the following link
Lists
This Strain isn't in any lists. Upload a list.

1 Alleles

Public Name
nx61

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00016935 ifta-1 C54G7.4 Caenorhabditis elegans