WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00036140 Gene Name  CBG16074
Sequence Name  ? CBG16074 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Sterile alpha motif domain; Ankyrin repeats (many copies); Ankyrin repeat; Phosphotyrosine interaction domain (PTB/PID); PTB/PI domain; Sterile alpha motif/pointed domain superfamily; Domain of unknown function DUF3447; SAM domain (Sterile alpha motif); Ankyrin repeat-containing domain superfamily; Ankyrin repeats (3 copies); and PH-like domain superfamily. Is an ortholog of C. elegans C11E4.6. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG16074a.1 CBG16074a.1   [unknown]
Transcript:CBG16074b.1 CBG16074b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG16074a CBG16074a   [unknown]
CDS:CBG16074b CBG16074b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG16074, GATAAGAACCTGCCAATCGACGGATCCATGGTTAGATGCAAACACAACGCCAGTACACTC, WBGene00036140   Expr1058490 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term