WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00131542 Gene Name  Cjp-sem-4
Sequence Name  ? CJA12338 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Zinc-finger of C2H2 type; Zinc finger, C2H2 type; Zinc finger C2H2-type; and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans sem-4. In C. elegans, sem-4 is involved in cell differentiation; regulation of gene expression; and response to oxidative stress. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA12338a.1 CJA12338a.1   [unknown]
Transcript:CJA12338b.1 CJA12338b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA12338a CJA12338a   [unknown]
CDS:CJA12338b CJA12338b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-sem-4, CATTCACCACACGTGGCAACTTGAAAGTGCACATGGGCACACACTCGTGGCAACAAAGTC, WBGene00131542   Expr1070695 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term