WormMine: Strain WBStrain00047566

• WormBase ID: WBStrain00047566
• CGC Received: 2019-11-05
• Genotype: K12C11.6(gk5190) I; sre-40(gk5191) II.
• Laboratory: CGC
• Mutagen: EMS
• Name: VC4113
• Outcrossed: x0
• Remark: Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5190 mutation is G->A, flanking sequences CAAAAATCGAGATGAGTTAGTAAGCCGGAG and TGAGTTAATCATACAAAATCAAAAAAAAAA. The gk5191 mutation is A->C, flanking sequences CCAATCTATAGCATAGTATAAAAATATTTC and TATTCTTGAAAGAAGTTATAATATTGCAGA.
• Species: Caenorhabditis elegans

2 Alleles

Public Name
gk5190
gk5191

1 Data Sets

• WormBaseAcedbConverter

2 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00020225	sre-40	T05A7.8	Caenorhabditis elegans
WBGene00045052	K12C11.6	K12C11.6	Caenorhabditis elegans