WormMine: Gene WBGene00126517

• WormBase Gene ID: WBGene00126517
• Gene Name: CJA07313
• Sequence Name: CJA07313
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Solute-binding protein family 3/N-terminal domain of MltF; Bacterial extracellular solute-binding proteins, family 3; and Uncharacterized protein T25E4.2-like. Is an ortholog of C. elegans W02A2.5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA07313a.1	CJA07313a.1		[unknown]
Transcript:CJA07313b.1	CJA07313b.1		[unknown]
Transcript:CJA07313c.1	CJA07313c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA07313a	CJA07313a		[unknown]
CDS:CJA07313b	CJA07313b		[unknown]
CDS:CJA07313c	CJA07313c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1073906
• Remark: CJA07313, GCCCAATTGCACTTTACGACGAGCGAGCAGTACAATGATATTGATGTGATGAGACTTATC, WBGene00126517
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term