2 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00002957 | let-858 | F33A8.1 | Caenorhabditis elegans |
WBGene00045350 | mir-788 | T01B10.6 | Caenorhabditis elegans |
WormBase ID | WBStrain00051629 | CGC Received | 2022-03-01 |
Genotype | mir-788(umn77[mir-788p+SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. | Laboratory | CGC |
Mutagen | CRISPR_Cas9 | Name | CGC170 |
Outcrossed | x0 | Remark | Nuclear mScarlet-I was inserted in place of the endogenous mir-788 pre-miRNA via CRISPR/CAS9. Left Flanking: TCTGTGCGTATTACAAATTTTCAGCTGGAA, Right Flanking: GAATAGCAGTTTTCAAAATTGTGAGTTGCT. sgRNA: CTGCAAATGGAAGTTAGAAG. |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00002957 | let-858 | F33A8.1 | Caenorhabditis elegans |
WBGene00045350 | mir-788 | T01B10.6 | Caenorhabditis elegans |