3 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001063 | dpy-1 | M01E10.2 | Caenorhabditis elegans |
| WBGene00004267 | rab-3 | C18A3.6 | Caenorhabditis elegans |
| WBGene00022051 | rep-1 | Y67D2.1 | Caenorhabditis elegans |
| WormBase ID | WBStrain00029076 | CGC Received | 2014-12-15 |
| Genotype | rep-1(ok3296) jsIs682/sC1 [s2303) [dpy-1(s2170)] jsIs682 III. | Laboratory | CGC |
| Made By | WBPerson5776 | Name | NM4431 |
| Outcrossed | x0 | Remark | rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals with GFP::RAB-3 mislocalized to neuronal cell bodies. Presence of jsIs682 makes definitive identification of ok3296 homozygotes much easier. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4337. Reference: Dour S and Nonet ML. In preparation. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001063 | dpy-1 | M01E10.2 | Caenorhabditis elegans |
| WBGene00004267 | rab-3 | C18A3.6 | Caenorhabditis elegans |
| WBGene00022051 | rep-1 | Y67D2.1 | Caenorhabditis elegans |
