2 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001063 | dpy-1 | M01E10.2 | Caenorhabditis elegans |
| WBGene00022051 | rep-1 | Y67D2.1 | Caenorhabditis elegans |
| WormBase ID | WBStrain00029073 | CGC Received | 2014-12-15 |
| Genotype | rep-1(ok3296)/sC1(s2023) [dpy-1(s2170)] III. | Laboratory | CGC |
| Made By | WBPerson451 | Name | NM4337 |
| Outcrossed | x0 | Remark | rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4431. Reference: Dour S and Nonet ML. In preparation. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001063 | dpy-1 | M01E10.2 | Caenorhabditis elegans |
| WBGene00022051 | rep-1 | Y67D2.1 | Caenorhabditis elegans |
