1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00006818 | unc-86 | C30A5.7 | Caenorhabditis elegans |
| WormBase ID | WBStrain00029928 | CGC Received | 2018-02-19 |
| Genotype | unc-86(ot893[unc-86::3xFlag::mNeonGreen::AID]) III. | Laboratory | CGC |
| Name | OH15227 | Outcrossed | x3 |
| Remark | unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, (2018). BRN3-type POU homeobox genes maintain the identity of mature postmitotic neurons in nematodes and mice. Curr Biol (in press). | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00006818 | unc-86 | C30A5.7 | Caenorhabditis elegans |
