WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00183057 Gene Name  Cjp-hecd-1.2
Sequence Name  ? CJA27485 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Ankyrin repeat-containing domain superfamily; Armadillo-type fold; and Armadillo-like helical. Is an ortholog of C. elegans hecd-1. In C. elegans, hecd-1 is involved in several processes, including determination of adult lifespan; hemidesmosome assembly; and regulation of Notch signaling pathway. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA27485.1 CJA27485.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA27485 CJA27485   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA28452, ATCGAAATGGTACAGTACCTGTGCGACAAGGGTGCCGATGTAAACAAGGGTCACAAGAGC, WBGene00184026   Expr1085482 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA27485, GCAAAATGATGGATCCAGCCGAGCTGGCGACACACAGTAATCTCGTCGAACATCTCATCT, WBGene00183057   Expr1091463 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term